CRISPR-Cas12a (Cpf1) crRNA Oligo Entry
Disclaimer for Clinical and Diagnostic Applications
IDT RUO products are manufactured in accordance with ISO 9001 and are intended for research use only. For clarity, RUO products are not intended for human use, including any clinical or diagnostic applications. If you are interested in using IDT products for clinical applications, please contact IDT application support to learn more about alternative manufacturing services available at IDT.
Need an HDR donor design? Click here.
IDT RUO products are manufactured in accordance with ISO 9001 and are intended for research use only. For clarity, RUO products are not intended for human use, including any clinical or diagnostic applications. If you are interested in using IDT products for clinical applications, please contact IDT application support to learn more about alternative manufacturing services available at IDT.
Loading Page...
Warning!
(5' → 3')
-
5' Dye 5' Code 3' Quencher 3' Code Other Show Other 5' Dyes Hide Other 5' Dyes
Base Notations
- RNA, expressed as 'r_', for example rA, rU.
- 2' O-methyl RNA bases are entered as 'm_'.
- Phosphorothioated RNA bases are entered as 'r_*'.
- Phosphorothioated 2'-O-methyl RNA bases are entered as 'm_*'.
# Bases:
Include reverse complement
Looking for controls?
NOTE:The same positive and negative controls can be used for both A.s. and L.b. Cas12a (Cpf1) nucleases.
To order, increase the # of items, then copy and paste the appropriate name and sequence from the following list into this ordering page:| Cas12a (Cpf1) positive control crRNAs | |
|---|---|
| Item Name: | Cas12a (Cpf1) Pos Ctrl crRNA, Human HPRT |
| Sequence: | GGTTAAAGATGGTTAAATGAT |
| Item Name: | Cas12a (Cpf1) Pos Ctrl crRNA, Mouse HPRT |
| Sequence: | GGATGTTAAGAGTCCCTATCT |
| Item Name: | Cas12a (Cpf1) Pos Ctrl crRNA, Rat HPRT |
| Sequence: | ATGCTTAAGAGGTATTTGTTA |
| Cas12a (Cpf1) negative control crRNAs | |
|---|---|
| Item Name: | Cas12a (Cpf1) Neg Ctrl crRNA #1 |
| Sequence: | CGTTAATCGCGTATAATACGG |
| Item Name: | Cas12a (Cpf1) Neg Ctrl crRNA #2 |
| Sequence: | CATATTGCGCGTATAGTCGCG |
| Item Name: | Cas12a (Cpf1) Neg Ctrl crRNA #3 |
| Sequence: | GGCGCGTATAGTCGCGCGTAT |
Did you know?
Batch editing
Edit scale, purification, normalization and services across multiple items simultaneously.Bulk Input
Questions about using this page? Watch a video demo.
OR
# Entries:
| Code | Scale |
|---|---|
| Code | Purification |
|---|---|
| Code | Modification |
|---|---|
Processing...
Change All
Include reverse complement
** Change all options will only apply where option is applicable.
Melting Temperature Settings
| Parameter sets | |
|
|
|
|
|
|
| Target type | |
| Oligo Conc | µM |
| Na+ Conc | mM |
| Mg++ Conc | mM |
| dNTPs Conc | mM |